| In Silico Biology 5, 0045 (2005); ©2005, Bioinformation Systems e.V. |
Environmental Microbiology Division (Gheru Campus), Industrial Toxicology Research Center
P.O. Box 80, Mahatma Gandhi Marg, Lucknow-226001, India
* Corresponding author
Email: rishishanker1@rediffmail.com
FAX: +91-522-2628227
Edited by H. Michael; received May 30, 2005; revised and accepted September 12, 2005; published October 09, 2005
Diarrheagenic E. coli strains contribute to water related diseases in urban and rural environment in developing and developed world. E. coli pathotype and pathogenicity varies due to complex multifactorial mechanism involving a large number of virulence factors. Rapid assessment of the virulence pattern of E. coli isolates is possible by Real-Time PCR probes like TaqMan. For designing TaqMan probes and primers for multiplex PCR selected E. coli gene sequences: stx1, stx2, hlyA, chuA, eae, lacZ, lamB and fimA were retrieved from NCBI’s GenBank database. The alignment of the multiple sequences and analysis of conserved sequences was carried out using ClustalW and BLAST programs. The primers and Taqmen probes were designed using Beacon Designer software version 2.1 for two multiplexed PCR assays. In silico PCR simulation of these assays showed PCR products for stx2 (248bp) stx1 (102 bp), lacZ (228bp) and lamB (86 bp) in multiplex #1 and eae (200bp), chuA (147 bp), hlyA (141bp) and fimA (79 bp) in multiplex #2, respectively. These multiplexed PCR amplification products and probes can be used to identify and confirm presence of O157:H7/ H7-, O157:H43/45 and O26:H¯/H11 serotypes. In conclusion, multiplex Real-Time Polymerase Chain Reaction oligomers and TaqMan probes designed and validated in silico will be helpful in management of water quality and outbreaks, by improving specificity and minimizing time needed for in vitro verification work.
Keywords: E. coli O157, TaqMan probe, polymerase chain reaction
Diarrheagenic E. coli strains contribute to water borne diseases, infecting millions of humans each year in industrialized and developing countries [Johnson and Lvovsky, 2001]. The World Bank estimates that more than 30 million life years are lost annually due to water-related diseases in India [Brandon, 1995]. Escherichia coli strains constitute serologically and biochemically an extremely heterogeneous group of bacteria. In the last decade, certain serotypes of E. coli especially O157:H7 have been increasingly recognized as etiological agents of sporadic and epidemic outbreaks of diarrhea, hemorrhagic colitis and hemolytic uremic syndrome [Mead and Griffin, 1998; Jothikumar and Griffiths, 2002; Lekowska-Kochaniak et al., 2002]. Dairy cattle are considered important reservoirs for E. coli O157: H7. There have been recent reports on entry of cattle waste wash in river water used for irrigation of crops and processing drinking water [D’ Souza, 2003]. Recently, certain sorbitol non-fermenting cefixime-tellurite resistant E. coli strains were detected in recreational waters of river Gomti in Lucknow city [R. Shanker, unpublished data]. SMAC (Sorbitol MacConkey Agar) developed for isolation of E. coli O157:H7 has proven inadequate for detection of sorbitol fermenting (SF) non-O157: H7 strains including stx2 positive and negative SF E. coli O157: H¯. To identify these organisms it is necessary to either detect stx phenotype or stx and other virulence genes [Karch and Bielaszewska, 2001].
A molecular technique, Polymerase Chain Reaction (PCR) has been applied in clinical diagnostics. However, lack of sequence specific identification of genes being amplified and the quantitative detection of amplification products make the PCR assays inefficient for detection of all known strains of a given species. Real-Time PCR offers rapid, simultaneous amplification and sequence specific detection of 2-4 target genes in a single reaction tube. A real-time PCR probe strategy called the TaqMan assay capitalizes on the 5’-exonuclease activity of Taq polymerase to cleave a labeled hybridization probe during the extension phase of PCR. In a fluorescent TaqMan assay, the probe is labeled at the 5’ end with a fluorescent reporter molecule, usually a tetramethylrhodamine derivative, which acts as a quencher for the reporter. When the two fluorophores are fixed at opposite ends of the 20-30 nucleotides probe and reporter fluorophore is excited by an outside light source, the normal fluorescence of the reporter is absorbed by the nearby quencher, and no reporter fluorescence is detected. Taq polymerase digests the bound probe during extension from one of the primers, freeing the reporter from the quencher, and reporter fluorescence can be then detected and measured. Thus, TaqMan assay demands design of three nucleic acid oligomers, two PCR primers and an internal oligonucleotide probe located in the PCR product amplified by the primers.
TaqMan probes have been used to rapidly identify viral pathogens with detection limits of 5 to 25 genomes and five copies of DNA in environmental and pure samples [Linssen et al., 2000; Weinberger et al., 2000]. However, the information on application of TaqMan probes for detection of Escherichia coli in water is meager [Frahm and Obst, 2003]. Therefore, multiplexed TaqMan probes are needed that are species as well as serotype specific for exact identification of pathogenic organism in water. This study presents the feasibility of computational exercises, to develop multiplexed TaqMan probes for detection of Enterohemorrhagic E. coli (EHEC) variants that contaminates water and food.
E. coli virulence and house keeping genes were chosen based on proven role in E. coli pathogencity. The full-length sequence of E. coli virulent genes stx1 (Shiga like toxin type 1) , stx2 (Shiga like toxin type 2), hlyA (Enterohemolysin) , chuA (Heam iron transport), eae (Attaching and effacing protein) and housekeeping genes lacZ (β-galactosidase), lamB (Maltose Transport protein), and fimA (Fimbrial major subunit type-1) sequence were retrieved from GenBank (Table 1). For analyses of conserved regions the multiple sequence alignment programs were used (Table 1). For designing TaqMan probes and primers for multiplex PCR highly conserved regions of the following selected sequences (Table 2) were used: stx1 (GenBank # AF461169) , stx2 (GenBank # AF461174), hlyA (GenBank # X94129) , chuA (GenBank # U67920), eae (GenBank # AF081183) and housekeeping genes lacZ (GenBank # V00296), lamB (GenBank # M26131), and fimA (GenBank # AF206659). The parameters for designing of multiplex primers and TaqMan probes were as follows: length of primer: 20-24mer; length of TaqMan probe: 20-24mer; primer annealing temp in range of 55-59OC; annealing temp. of TaqMan was 100C higher than primer annealing temp., amplicon length was 75-250bp, multiplexing maximum ΔG = -6 kcal/mol; maximum bases between primer and TaqMan = 10 and maximum primer pair Tm mismatch = 20C. The probes were optimized using Beacon Designer software version 2.1 (Table 1).
| Table 1: | Softwares used for designing and in-silico validation of primers and probes. |
| Programs | Use |
| Retrieval of Sequences and homology search: http://www.ncbi.nlm.nih.gov/BLAST |
Free, Online |
| Analysis of conserved regions and alignment of the multiple sequences: http://www.ebi.ac.uk/clustalW |
Free, Online |
| Designing Primers and Taqmen probes: Beacon Designer software version 2.1 | Commercial (Premier Biosoft. International, Palo Alto,California) |
| PCR simulation: (http://www.in-silico.com.) |
Free, Online |
The specificity of multiplex primers and TaqMan probes was validated against known microbial genomes and sequences by BLAST (Basic Local Alignment Search Tool) program (http://www.ncbi.nlm.nih.gov) to ensure no homology was observed with known gene sequences of water-borne pathogens. Selected multiplex PCR amplification primers were validated in-silico (http://www.in-silico.com.), to ensure that each primer pair targeted the conserved region in the genome of pathogenic E. coli.
The genome of E. coli exhibits high plasticity with many virulence genes located on mobile genetic elements like plasmids, phages and transposons. This may allow new combinations of virulence genes to emerge in the future making association of specific virulence genes with certain categories of E. coli more difficult. Therefore, nucleic acid signatures conserved among multiple existing strains were searched to select sequence regions of the genome likely to be conserved in evolving strains. Multiple sequence alignments of all sequences available for virulence gene(s) were carried out to generate file of conserved contigs for designing TaqMan probes (Table 1 and 2). These conserved contigs were evaluated for potential TaqMan probes in the set of four multiplexed PCR products in-silico (Table 3, Fig. 1).
| Table 2: | GenBank sequence identification numbers of E.coli genes used for BLAST analysis to determine conserved sequences for strain specific probes. |
| E.coli Gene / Accession number | |||||||
| lacZ | lamB | fimA | stx1 | stx2 | eae | hlyA | chuA |
| V00296 | M26131 | AF206659 | AF461172 | AF461174 | Z11541 | X94129 | U67920 |
| J01636 | J01648 | AF206658 | AB030485 | AF461170 | X60439 | AF074613 | AF280396 |
| V00298 | AF206652 | AF461169 | AF461165 | AF081183 | U12572 | ||
| U20815 | AF461166 | AB048837 | AF081182 | X86087 | |||
| AF206647 | Z36899 | AB048233 | AJ705049 | X79839 | |||
| AF490880 | AJ251325 | AF175707 | AF081184 | AB032930 | |||
| M27603 | AB015056 | AB035143 | U59502 | ||||
| X00981 | AB035142 | AB046175 | AF081187 | ||||
| AF206650 | Z36900 | AY143337 | |||||
| AF490890 | AB048232 | AY143336 | |||||
| AF206653 | L04539 | AB048835 | |||||
| AB083044 | AF461173 | ||||||
| AY135685 | AY443057 | ||||||
| Z36901 | Z37725 | ||||||
| AB048231 | AY443054 | ||||||
| AF524945 | |||||||
| AJ272135 | |||||||
| X81418 | |||||||
In the present study, the designed multiplex reactions take into account the sensitivity of probe labeled with different fluorophores, as least 3 probes in the multiplexed reaction will be effective any time at any time and will preclude false or negative results (Table 3). For example, all E. coli strain will show presence of lacZ, lamB and fimA genes. The enzyme β-D galactosidase encoded by lacZ gene has been the basis of detection of E. coli and coliforms in water. The gene lamB encodes for maltose transport protein while gene fimA encodes for fimbrial subunit type-1 in both pathogenic and non-pathogenic E. coli strains [Mead and Griffin, 1998]. The presence of lacZ, lamB, stx1, and stx2 genes will indicate O157:H7 serotype involved in hemorrhagic colitis while the presence and /or absence of stx1 and/or stx2 can be indicative of O157: H43/45 and O26:H¯/H11 variants [Zhang et al., 2000]. However, the presence of fimA, eae, hlyA, chuA, will confirm O157: H7¯ serotype [Karch and Bielaszewska, 2001]. Recently, shiga toxin based PCR assays have been recommended for diagnosis of enterohemorrhagic E. coli infection in clinical microbiology laboratories [Gavin and Thomson, 2004]. Our in silico validation of the multiplexed Real-Time PCR indicates that TaqMan probes will increase specificity of detection of Enterohemorragic E. coli in water (Table 3 and Fig. 1).
| Table 3: | Nucleotide sequences of candidate oligomers and TaqMan probes for multiplex Real-Time PCR for E. coli O157 serotypes. |
| Gene | Sequence of PCR oligomers/TaqMan Probe | Tm (OC)(ΔG ValueCross Dimer:Internal) | Product Length (Location with in target gene) and Position of Probe |
| Multiplex #1 | |||
| lacZ | F. 5’CTGGCGTAATAGCGAAGAGG 3’
R. 5’ GGATTGACCGTAATGGGATATG3’ 5’ CCGCACCAATCGCCCTTCCCA 3’ |
56.3
55.0 65.9 (0) |
228bp
(105-332) 126 |
| lamB | F. 5’CGAATGTGAAACTTATGCTGAAT 3’
R. 5’ CCACGTTAGTGTCGAAATAGAA3’ 5’TCGCCCTCTTTCCACACTTCCTGA 3’ |
54.7
54.8 64.6 (-1.8) |
86bp
(282-367) 338 |
| stx1 |
F. 5’CCATTCGTTGACTACTTCTTATCT 3’
R.5’GCTGTCACAGTAACAAACCG 3’ 5’AACATCGCTCTTGCCACAGACTGC 3’ |
55.3
55.4 64.9 (-2.7) |
102bp
(754-855) 834 |
| Multiplex #2 | |||
| fimA | F. 5’CCGTTCAGTTAGGACAGGTT 3’
R. 5’TGAATGTTAAAACCGACAGCA 3’ 5’AACTGGTTGCTCCGTCCTGTGC 3’ |
55.2
54.7 64.0(-2.7) |
79
(161-239) 217 |
| eae | F. 5’CTGAGATTAAGGCTGATAAGACAA 3’
R. 5’ GGAAGTTAGTGTTATCGTCGC 3’ 5’CATCATTTCCCGTGGTTGCTTGCG 3’ |
55.2
55.2 64.4 (-2.3) |
200
(1982-2181) 2155 |
| chuA | F. 5’CCTGAAAATCAAACGGCTACT 3’
R. 5’ AACACCATCGACAAGAACCA 3’ 5’CCGATCTGCTGCGTCATGTTCCTG 3’ |
54.8
55.4 65(0) |
147
(662-808) 690 |
| hlyA | F. 5’GGCTGTTATGCTGGCTATCA 3’
R. 5’ TTATGAAAGGCTGCGAGTAAAG 3’ 5’TCCTCTTTCTTTCCTGGCTGCTGC 3’ |
55.7
55.3 64.1 (-0.9) |
141
(894-1034) 915 |
| Sequence of TaqMan Probe, position of probe on sequence and ΔG value is presented in bold letters |
It can be concluded that comprehensive computational exercises have the potential to generate economically viable multiplex TaqMan probes, for management of water quality and outbreaks, by improving specificity and minimizing time needed for in vitro verification work.
Thanks are due to Prof. Y. K. Gupta, Director, Industrial Toxicology Research Center for keen interest in the study. The grant of Junior Research Fellowship to SR by CSIR, New Delhi is acknowledged. The ITRC manuscript number is 2376.